cd274 promoter  (Addgene inc)

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 upregulates expression of PD-L1 and CCL2. (A) mRNA-seq analysis of ZEB2-overexpressing SW480 cells and analysis of KEGG pathways affected by ZEB2 expression. The size of each circle represents the number of genes involved in the corresponding pathway and the color scale denotes the P-value (upper). Changes in expression of cytokine-related genes in ZEB2-overexpressing SW480 cells are vs. those in control cells (lower). (B) RT-qPCR of CCL2 , CCL28 , CXCL2 , CXCL3 , CXCL6 and CXCL12 levels in ZEB2-overexpressing vs. control SW480 cells (upper) and in ZEB2-suppressed vs. control SNU-398 cells (lower; n=4). (C) RT-qPCR of CD274 mRNA levels in ZEB2-overexpressing vs. control SW480 cells (left) and in ZEB2-suppressed vs. control SNU-398 cells (right; n=4). (D) Analysis of CCL2 and PD-L1 protein levels in ZEB2-overexpressing vs. control SW480 cells (left), in ZEB2-suppressed vs. control SNU-398 cells (middle) and in ZEB2-overexpressing vs. control PC3 cells (right). Densitometric quantification of bands on the immunoblot was performed, with β-actin or GAPDH as a loading control. (E) Reporter analysis of CD274 and CCL2 promoter activity in ZEB2-overexpressing vs. control SW480 cells (upper) and in ZEB2-suppressed vs. control SNU-398 cells (lower; n=4). (F) Flow cytometry analysis of PD-L1 expression in SW480 cells transfected with ZEB2, TWIST1, or SNAIL expression vectors (n=3). Cells treated with IFN-γ or transfected with a PD-L1 expression vector were used as positive controls. Immunoblot analysis confirmed overexpression of ZEB2 (anti-myc), TWIST1 (anti-flag) and SNAIL (anti-SNAIL). (G) ELISA to measure secreted levels of CCL2 in conditioned medium from ZEB2-suppressed vs. control SNU-398 cells (n=3). (H, I) Scatter plots of ZEB2 mRNA expression vs. CD274 (H) and CCL2 (I) mRNA expression in colorectal adenocarcinoma (data from TCGA, Firehose Legacy and TCGA, Nature 2012). Correlations were statistically analyzed using the Spearman test. Spearman's correlation coefficients and equations were automatically generated using the cBioPortal webpage tool. (J) Kaplan-Meier analysis showing the relationship between overall survival of colon cancer (CPTAC-2, Prospective, Cell 2019; n=106) and pancreatic adenocarcinoma (TCGA, Firehose Legacy; n=178) patients and expression of ZEB2 and CD274 mRNA. P-values were calculated by the log-rank test. Values represent the mean ± standard deviation. * P<0.05; ** P<0.01; *** P<0.001; N.S, not significant. ZEB2, Zinc Finger E-Box Binding Homeobox 2; PD-L1, programmed cell death 1 ligand 1; CCL2, C-C motif chemokine ligand 2; KEGG, Kyoto Encyclopedia of Genes and Genomes; RT-qPCR, reverse transcription-quantitative PCR; ELISA, enzyme-linked immunosorbent assay; TCGA, The Cancer Genome Atlas; sh, short hairpin.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Expressing, Control, Quantitative RT-PCR, Western Blot, Activity Assay, Flow Cytometry, Transfection, Plasmid Preparation, Over Expression, Enzyme-linked Immunosorbent Assay, Generated, Standard Deviation, Binding Assay, Reverse Transcription, Real-time Polymerase Chain Reaction

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 cooperates with SP1 to promote transcription of CD274 and CCL2 by binding directly to their promoters. (A) SW480 cells were co-transfected with siRNA specific for SP1 (siSP1) and with a ZEB2 expression vector, for 48 h prior to immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. (B) RT-qPCR of CD274 (upper) and CCL2 (lower) levels in SW480 cells co-transfected with siSP1 and the ZEB2 expression vector (n=4). (C) Mutation analysis of the SP1 site in the CD274 and CCL2 promoters. SW480 cells were transfected with reporter constructs containing SP1 site mutations and reporter activity was measured (n=4). Values represent mean ± SD. *** P<0.001, vs. vector + control siRNA; $$$ P<0.001, vs. ZEB2 + control siRNA. (D) ChIP analysis of the interaction between ZEB2 and SP1 and the CD274 and CCL2 promoters. Chromatin fragments from SNU-398 cells were immunoprecipitated by normal mouse IgG (lane 1), anti-ZEB2 (lane 2), or anti-SP1 (lane 3) and data were analyzed by semiquantitative PCR using CD274 (-181/-41) and CCL2 (-115/+25) promoter primers. The input control (1%) is shown in lane 4. Irrelevant regions (-807/-660 for CD274 and -1820/-1675 for CCL2 ) were also analyzed. ZEB2, Zinc Finger E-Box Binding Homeobox 2; si, small interfering; RT-qPCR, reverse transcription-quantitative PCR; PD-L1, programmed cell death 1 ligand 1; CCL2, C-C motif chemokine ligand 2; ChIP, chromatin immunoprecipitation.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Binding Assay, Transfection, Expressing, Plasmid Preparation, Western Blot, Control, Quantitative RT-PCR, Mutagenesis, Construct, Activity Assay, Immunoprecipitation, Reverse Transcription, Real-time Polymerase Chain Reaction, Chromatin Immunoprecipitation

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 suppresses T cell activation by upregulating PD-L1. (A) Jurkat cells transfected with NFAT-reporter construct were co-cultured for 24 h with stable SNU-398 cells (control vs. ZEB2-suppressed cells) and luciferase activity was measured 24 h after stimulation with PMA and ionomycin (n=4). (B) IL-2 secreted by Jurkat cells co-cultured with stable SNU-398 cells was measured in an ELISA (n=3). (C) Jurkat cells were co-cultured for 24 h with stable SNU-398 cells and then stimulated for 24 h with PMA and ionomycin prior to immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. Phosphorylated proteins were normalized against the corresponding total protein values. (D) Effect of an anti-PD-1 antibody on NFAT activity in Jurkat cells co-cultured with stable SNU-398 cells (n=4). Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001. $$$ P<0.001 vs. Jurkat + PMA + ionomycin. ZEB2, Zinc Finger E-Box Binding Homeobox 2; PD-L1, programmed cell death 1 ligand 1; NFAT, Nuclear factor of activated T cells; ELISA, enzyme-linked immunosorbent assay; PMA, phorbol 12-myristate 13-acetate; p-, phosphorylated; sh, short hairpin.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Activation Assay, Transfection, Construct, Cell Culture, Control, Luciferase, Activity Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Binding Assay

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: ZEB2 SUMOylation through PC2 is required for ZEB2 acting as a transcriptional activator and playing subsequent cellular functions. (A) SW480 cells were transfected with ZEB2WT and ZEB2_K391/866R for 48 h prior to lysis and immunoblot analysis. (B) Reporter assay of ITGA5 (integrin α5), VIM (vimentin), VEGFA , CDH1 , CD274 and CCL2 promoter activity in SW480 cells transfected with ZEB2WT and ZEB2_K391/866R (n=4). (C) Invasion (representative fields at magnification, ×100), (D) survival and (E) anchorage-independent growth of SW480 cells transfected with ZEB2WT and ZEB2_K391/866R (n=3). (F) SW480 cells were co-transfected with shRNA specific for CBX4 (shPC2) and with a ZEB2-expression vector, for 48 h prior to lysis and immunoblot analysis. Densitometric quantification of bands on the immunoblot was performed, with GAPDH as a loading control. Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001; N.S, not significant. ZEB2, Zinc Finger E-Box Binding Homeobox 2; SUMO, small ubiquitin-like modifier; CCL2, C-C motif chemokine ligand 2; PD-L1, programmed cell death 1 ligand 1; VEGF, vascular endothelial growth factor; sh, short hairpin; WT, wild type; Mut, mutant.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Transfection, Lysis, Western Blot, Reporter Assay, Activity Assay, shRNA, Expressing, Plasmid Preparation, Control, Binding Assay, Ubiquitin Proteomics, Mutagenesis

Journal: International Journal of Oncology

Article Title: Cooperation between ZEB2 and SP1 upregulates PD-L1 and CCL2 to promote the immunosuppressive activity of tumor cells

doi: 10.3892/ijo.2025.5801

Figure Lengend Snippet: SUMOylation of ZEB2 is required for cooperation between ZEB2 and SP1. Reporter assay to determine transcriptional activity of SP1 in SW480 cells (n=4). (A) Cells were transfected with ZEB2WT and ZEB2_K391/866R expression vectors for 48 h. (B) Cells were co-transfected with a ZEB2 expression vector and siRNA specific for CBX4 (siPC2) for 48 h. Values represent mean ± SD. * P<0.05; ** P<0.01; *** P<0.001. (C) SW480 cells transfected with ZEB2WT and ZEB2_K391/866R expression vectors were treated with cycloheximide for the indicated times prior to lysis and immunoblot analysis. (D) A cytosolic fraction and a nuclear fraction were prepared from 293E cells transfected for 48 h with ZEB2WT and ZEB2_K391/866R expression vectors. GAPDH and PARP were used as internal controls for the cytosolic and nuclear fractions, respectively. (E) Co-immunoprecipitation analysis of the interaction between ZEB2 and SP1 in 293E cells co-transfected with ZEB2 (WT vs. K391/866R) and SP1 expression vectors. (F) Kaplan-Meier analysis showing the probability of progression-free survival of patients with colorectal adenocarcinoma (TCGA, PanCancer Atlas; n=588) in relation to CBX4 mRNA expression. (G) Overall survival of patients with colorectal adenocarcinoma (TCGA, PanCancer Atlas; n=568) in relation to expression of ZEB2 and CBX4 mRNA. P-values were calculated using the log-rank test. SUMO, small ubiquitin-like modifier; ZEB2, Zinc Finger E-Box Binding Homeobox 2; CCL2, C-C motif chemokine ligand 2; PD-L1, programmed cell death 1 ligand 1; VEGF, vascular endothelial growth factor; TCGA, The Cancer Genome Atlas; si, small interfering; WT, wild type; Mut, mutant.

Article Snippet: The human CD274 (PD-L1) promoter (-3153/+1) reporter was generated from the CD274 promoter (-3153/-82) construct (purchased from Addgene; cat. no. 107004) by inserting the sequence 5′- GTG GGCGGGACC CCGCCTCCGGGCCTGGCGCAACGCTGA GCA GCT GGC GCG TCC CGC GCG GCC CCA GTT CTG CGC AGC TTC C-3′ (the SP1 site is underlined).

Techniques: Reporter Assay, Activity Assay, Transfection, Expressing, Plasmid Preparation, Lysis, Western Blot, Immunoprecipitation, Ubiquitin Proteomics, Binding Assay, Mutagenesis

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: RORA-downregulated PD-L1 promotes cytotoxic T-cell activity in melanoma cells. A and B, Analysis of immune checkpoint genes in SK-MEL-28 and A375 cells with or without RORA overexpression (vector or RORA-ha oe). qRT-PCR ( A ) and immunoblotting and quantification ( B ) of the expression of each immune checkpoint gene. n = 3. The experiments were repeated three times. C and D, PD-L1 expression in SK-MEL-28 and A375 cells treated with the RORA agonist nobiletin ( C ) or transfected with sgRORA and sgCont under IFNγ exposure ( D ), as determined by qRT-PCR and immunoblotting analysis. n = 3. The experiments were repeated three times. E–G FACS analysis of PD-L1 membrane expression after IFNγ exposure. n = 3. Three independent experiments were performed, and data are means ± SD from one representative experiment. H, Quantification of the results of the T-cell–mediated cancer cell killing assay. SK-MEL-28 and A375 cells transfected with sgCont or sgPD-L1 in the presence or absence of a RORA agonist (nobiletin, 100 µmol/L) under IFNγ exposure conditions were subjected to crystal violet staining to determine cell viability. The SK-MEL-28 and A375 transfectant to T-cell ratios were 1:3. The relative intensities of surviving cells are shown, with the T-cell untreated control sample set to 1. n = 3. Data shown are from one representative experiment of three replicates. Statistical significance in A–D and H was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Activity Assay, Over Expression, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Expressing, Transfection, Membrane, Staining, Control, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: RORA binds to the PD-L1 promoter and inhibits its transcription in melanoma cells. A and B, Normalized analysis of CD274 promoter activity in the SK-MEL-28 and A375 cell lines. The luciferase activity of the reporters containing the indicated CD274 gene promoter regions in cells transfected with shRORA ( A ) or with RORA-ha ( B ) is expressed as the relative change compared with that in the vector- or DMSO-treated cells. n = 3. Three independent experiments were performed. C and D, Binding motifs of RORA were predicted and determined in melanoma cell lines. C, Four predicted RORA-binding motifs (sites 1, 2, 3, and 4) are shown. D, RORA binding to the CD274 promoter was determined via ChIP–RT-PCR. ChIP–RT-PCR was conducted with HA and control IgG antibodies in the SK-MEL-28 and A375 cell lines. n = 3. Three independent experiments were performed. E and F, CD274 promoter constructs containing mutations in the binding region (mutant site 4) cause RORA-binding deficiency. n = 3. Data shown are from one representative experiment of three replicates. G, Lysates of SK-MEL-28 and A375 cells with RORA-ha overexpression were immunoprecipitated with anti-HA or control IgG antibodies, and then, the precipitates were blotted with anti-HDAC3 antibody. H, The structures of the GFP-tagged deleted constructs of RORA. Melanoma cells were transfected with the deletion constructs as indicated, and whole-cell lysates were immunoprecipitated and probed by immunoblotting using anti-GFP and anti-HDAC3 antibodies. NT, N-terminus; DBD, DNA-binding domain. I, mRNA and protein analysis of PD-L1 expression in SK-MEL-28 and A375 cells transfected with sgHDAC3 and negative control gRNA (sgCont) under IFNγ exposure via qRT-PCR and immunoblotting analysis. n = 3. The experiments were repeated three times. J, mRNA and protein analysis of PD-L1 expression in SK-MEL-28 and HA375 cells stably transfected with sgCont or sgHDAC3 in the presence or absence of the RORA agonist nobiletin (100 µmol/L) after IFNγ exposure. n = 3. The experiments were repeated three times. Statistical significance in A, B, D, F, I, and J was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Activity Assay, Luciferase, Transfection, Plasmid Preparation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Control, Construct, Mutagenesis, Over Expression, Immunoprecipitation, Western Blot, Expressing, Negative Control, Quantitative RT-PCR, Stable Transfection, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: DDX3X competitively interacts with RORA and inhibits T-cell cytotoxicity. A, Coimmunoprecipitation assay was conducted with an anti-HA antibody in melanoma cells. Red arrows, specific bands. B, The specific precipitated protein DDX3X was identified by mass spectrometry. C, Correlation analysis between the expression of PD-L1 and the top eight candidate proteins interacting with RORA in our dataset. D, HEK293T cells were transfected with RORA-ha and/or DDX3X-gfp. Cell lysates were immunoprecipitated with anti-HA magnetic beads (left) or anti-GFP magnetic beads (right), and then, the precipitates were detected with anti-GFP antibody (left) or anti-HA antibody (right). E and F, SK-MEL-28 and A375 cell nuclear lysates were isolated. G, The isolated nuclear lysates were immunoprecipitated with anti-HA/control IgG (top) or anti-DDX3X/control IgG antibodies (bottom), and then, the precipitates were blotted with anti-DDX3X (top) or anti-RORA (bottom) antibodies. H and I, The structures of the GFP-tagged deletion constructs of RORA and DDX3X. Melanoma cells were transfected with the deletion constructs as indicated, and whole-cell lysates were subjected to IP and probed by immunoblotting using anti-GFP, anti-HA, and anti-DDX3X antibodies. J, Overview of the interaction between human RORA-DDX3X (left) and RORA-HDAC3 (right) and a detailed enlarged view of their interaction through multiple hydrogen bonds. The RORA-binding residues are shown in orange, and the residues in blue indicate the DDX3X- or HDAC3-binding residues. K, Nuclear lysates of SK-MEL-28 and A375 cells with or without DDX3X-gfp overexpression were immunoprecipitated with an anti-RORA antibody, and then, the precipitates were blotted with an anti-DDX3X, anti-HDAC3, or anti-RORA antibody. L and M, T-cell–mediated cancer cell killing assay results. SK-MEL-28 or A375 cells with or without DDX3X overexpression/knockout under IFNγ exposure were cocultured with T cells at a 1:3 ratio for 24 to 36 hours and subjected to crystal violet staining to determine cell viability. The relative intensities of surviving cells are shown, with the T-cell untreated control sample set to 1. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. Statistical significance in L and M was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Co-Immunoprecipitation Assay, Mass Spectrometry, Expressing, Transfection, Immunoprecipitation, Magnetic Beads, Isolation, Control, Construct, Western Blot, Binding Assay, Over Expression, Knock-Out, Staining, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: DDX3X increases PD-L1 transcription by interacting with RORA and preventing it from binding the promoter of PD-L1. A and B, PD-L1 protein and mRNA levels in SK-MEL-28 and A375 cells with DDX3X overexpression or knockout in response to IFNγ stimulation were detected by immunoblotting and qRT-PCR. n = 3. Three independent experiments were performed. C and D, FACS analysis of cell surface–PD-L1 expression in melanoma cells with or without DDX3X overexpression or knockout after IFNγ exposure. n = 3. Three independent experiments were performed, and data are means ± SD from one representative experiment. E, PD-L1 promoter activity in melanoma cells transfected with sgDDX3X, control gRNA (sgCont), vector, or DDX3X overexpression plasmid (DDX3X oe) was measured by dual-luciferase reporter assays. n = 3. F and G, Analysis of PD-L1 levels in SK-MEL-28 and A375 cells stably overexpressing DDX3X-gfp in the presence of RORA-ha overexpression or the agonist nobiletin in response to IFNγ stimulation. Immunoblotting ( F ) and qRT-PCR analysis of PD-L1 expression ( G ). n = 3. Three independent experiments were performed. H, PD-L1 promoter activity was measured in melanoma cells transfected with or without DDX3X-gfp after treatment with the RORA agonist nobiletin. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. I, Analysis of PD-L1 promoter activity in melanoma cells transfected with or without truncated plasmids containing the N-terminus 1–441 or C-terminus 441–661 of DDX3X in the absence or presence of the RORA agonist nobiletin. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. J, T-cell–mediated cancer cell killing assay. SK-MEL-28 and A375 cells with or without DDX3X overexpression under IFNγ exposure were cocultured with activated T cells for 24 hours in the presence or absence of the agonist nobiletin (100 µmol/L) and subjected to crystal violet staining to determine cell viability. The cancer cell-to-T-cell ratio was 1:3. The relative intensities of surviving cells are shown, with T-cell untreated control sample set to 1. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. K, ChIP–qRT-PCR was conducted with HA and IgG antibodies in melanoma cells transfected with or without RORA-ha and/or DDX3X. n = 3. Three independent experiments were performed, and data shown are from one representative experiment. L, Scatterplot showing a significant positive correlation between the HDAC3, DDX3X, and RORA combined scores and PD-L1 expression. M, Kaplan‒Meier curves indicating the combined index of HDAC3, DDX3X and RORA expression and PFS time in our transcriptomic dataset. Statistical significance in B, E, G, and H–K was determined by a two-tailed unpaired t test while comparing two groups or by ordinary one-way ANOVA while comparing more than two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: Binding Assay, Over Expression, Knock-Out, Western Blot, Quantitative RT-PCR, Expressing, Activity Assay, Transfection, Control, Plasmid Preparation, Luciferase, Stable Transfection, Staining, Two Tailed Test

Journal: Cancer Research

Article Title: The Circadian Clock Component RORA Increases Immunosurveillance in Melanoma by Inhibiting PD-L1 Expression

doi: 10.1158/0008-5472.CAN-23-3942

Figure Lengend Snippet: A RORA agonist combined with CTLA4 blockade synergistically suppresses melanoma tumor growth in vivo . A and B, A total of 1 × 10 6 B16F10 cells were injected into the flanks of C57BL/6 mice, which were then treated with an anti-CTLA4 antibody and/or a RORA agonist (nobiletin). The tumor volumes ( A ) and summary of tumor weights ( B ) harvested after the mice were euthanized. n = 5. C, Kaplan‒Meier survival curves for each group. D–G, TILs in the tumors of each group ( n = 3) were analyzed and quantified by flow cytometry analysis. H, A schematic diagram of how RORA regulates the level of PD-L1 by interacting with HDAC3 or DDX3X and modulating antitumor T-cell immunity in melanoma. Statistical significance in A, B, F, and G was determined by a two-tailed unpaired t test. Statistical significances were determined by a two-tailed unpaired t test while comparing two groups.

Article Snippet: CD274 promoter plasmid was obtained from Addgene (107003, Addgene).

Techniques: In Vivo, Injection, Flow Cytometry, Two Tailed Test

Journal: The Journal of Clinical Investigation

Article Title: CRISPR screening identifies the deubiquitylase ATXN3 as a PD-L1–positive regulator for tumor immune evasion

doi: 10.1172/JCI167728

Figure Lengend Snippet: ( A ) Schematic of the deubiquitinase CRISPR knockout screening workflow. ( B ) Guides enriched in PD-L1–low and PD-L1–high populations with their fold enrichment. The guide code of each gene for further validation is indicated. ( C ) Guide hits described were validated by flow using individual guide knockouts. ( D ) Western blotting validation of ATXN3 knockout and PD-L1 expression with specific sgRNAs in LLC1 cells. WT, cells transfected with empty vector; KO, ATXN3-knockout stable cell strains. ( E and F ) Representative flow cytometry plots and quantification by MFI of cell-surface PD-L1 in LLC1 cells. ( G ) Western blotting analysis of ATXN3 and PD-L1 expression in A549 cells with knockout of ATXN3 . ( H and I ) Representative flow cytometry plots and quantification of cell-surface PD-L1 in A549 cells with knockout of ATXN3 . ( J and K ) Cd274 and Atxn3 mRNA levels were analyzed by reverse transcription quantitative PCR (RT-qPCR) in LLC1 cells. ( L and M ) Cd274 and Atxn3 mRNA levels were analyzed by RT-qPCR in B16 cells. ( N ) Correlation of CD274 mRNA levels with ATXN3 mRNA levels in lung cancer patients ( n = 22). ( O ) Correlation of CD274 with ATXN3 expression in multiple tumors based on TCGA data ( n = 40). C , F , and I – M : 2-tailed unpaired t test; N : Pearson’s correlation analysis. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: HEK293T cells were plated in 96-well plates and, the following day, cotransfected with 0.01 μg TK control ( Renilla luciferase), 0.05 μg ATXN3 plasmid, and 0.05 μg CD274 promoter reporter (firefly luciferase, Addgene, 107007) constructs using Lipofectamine 3000 (Invitrogen, catalog L3000150).

Techniques: CRISPR, Knock-Out, Biomarker Discovery, Western Blot, Expressing, Transfection, Plasmid Preparation, Stable Transfection, Flow Cytometry, Reverse Transcription, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

Journal: The Journal of Clinical Investigation

Article Title: CRISPR screening identifies the deubiquitylase ATXN3 as a PD-L1–positive regulator for tumor immune evasion

doi: 10.1172/JCI167728

Figure Lengend Snippet: ( A and B ) WT and ATXN3-KO cells were treated with IFN-γ (10 ng/mL) for 24 hours, and surface PD-L1 levels were analyzed. ( C ) ATXN3 interacts with IRF1 in transiently transfected HEK293T cells. ( D ) Interaction of endogenous ATXN3 and IRF1 in A549 cells. ( E ) HA-ubiquitin and FLAG-IRF1 expression plasmids were cotransfected with Myc-ATXN3 into HEK293T cells. IRF1 ubiquitination was determined by immunoprecipitation of IRF1 and immunoblotting with HA antibody. ( F and G ) FLAG-IRF1 was cotransfected with or without Myc-ATXN3 plasmids into HEK293T cells. The transfected cells were treated with cycloheximide (CHX) for different times. The protein levels of FLAG-IRF1 (top panel) and Myc-ATXN3 (middle panel) with β-actin control (bottom panel) were analyzed by Western blotting. Representative images ( F ) and quantification data from 3 independent experiments are shown ( G ). ( H and I ) Immunoblot analysis of IRF protein stability in WT and ATXN3-KO A549 cells as in F and G . ( J ) Interaction between ATXN3 and STAT3 in transfected HEK293T cells. ( K ) Endogenous interaction between ATXN3 and STAT3 in A549 cells. ( L ) The effect of ATXN3 on STAT3 ubiquitination was determined as in E . ( M and N ) The effects of ATXN3 on STAT3 protein stability were analyzed as in F and G . ( O and P ) Immunoblot analysis of STAT3 protein stability in WT and ATXN3-KO A549 cells as in H and I . ( Q ) The interaction between ATXN3 and STAT1 was tested in A549 cells. ( R ) ATXN3 enhances tumoral PD-L1 expression through protecting IRF1 and STAT3 from ubiquitination-induced protein degradation. B : Ordinary 1-way ANOVA; G , I , N , and P : 2-tailed unpaired t test; * P < 0.05, ** P < 0.01, *** P < 0.001. WCL, whole-cell lysate.

Article Snippet: HEK293T cells were plated in 96-well plates and, the following day, cotransfected with 0.01 μg TK control ( Renilla luciferase), 0.05 μg ATXN3 plasmid, and 0.05 μg CD274 promoter reporter (firefly luciferase, Addgene, 107007) constructs using Lipofectamine 3000 (Invitrogen, catalog L3000150).

Techniques: Transfection, Ubiquitin Proteomics, Expressing, Immunoprecipitation, Western Blot, Control

Journal: The Journal of Clinical Investigation

Article Title: CRISPR screening identifies the deubiquitylase ATXN3 as a PD-L1–positive regulator for tumor immune evasion

doi: 10.1172/JCI167728

Figure Lengend Snippet: ( A and B ) A549 cells were cultured under normoxia and hypoxia (hyp) (1% pO 2 ) for 48 hours, and surface PD-L1 levels were analyzed by flow cytometry and quantification. ( C ) ATXN3 specifically interacts with HIF-2α. HA–HIF-2α expression plasmid was cotransfected with or without FLAG-ATXN3 into HEK293T cells. Their interactions were examined by co-IP with anti-FLAG antibodies and by Western blotting with anti-HA antibodies. ( D ) The interaction between ATXN3 and HIF-1α was tested in transfected HEK293T cells. ( E ) Endogenous interaction between ATXN3 and HIF-2α in A549 cells. ( F ) HA-ubiquitin, FLAG–HIF-2α, and Myc-ATXN3 plasmids were cotransfected into HEK293T cells. HIF-2α ubiquitination was determined by immunoprecipitation of HIF-2α with anti-FLAG antibodies and immunoblotting with anti-HA antibody. ( G and H ) HIF-2α was cotransfected with or without ATXN3 plasmids into HEK293T cells. The transfected cells were treated with CHX for different times. The protein levels of HIF-2α (top panel) and ATXN3 (middle panel) were analyzed by Western blotting. β-Actin was used as a loading control (bottom panel). ( I and J ) Immunoblot analysis of HIF-2α protein stability in WT and ATXN3-KO A549 cells. ( K ) ATXN3 enhances hypoxia-induced PD-L1 expression through protecting HIF-2α from ubiquitination-induced protein degradation. B : Ordinary 1-way ANOVA; H and J : 2-tailed unpaired t test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: HEK293T cells were plated in 96-well plates and, the following day, cotransfected with 0.01 μg TK control ( Renilla luciferase), 0.05 μg ATXN3 plasmid, and 0.05 μg CD274 promoter reporter (firefly luciferase, Addgene, 107007) constructs using Lipofectamine 3000 (Invitrogen, catalog L3000150).

Techniques: Cell Culture, Flow Cytometry, Expressing, Plasmid Preparation, Co-Immunoprecipitation Assay, Western Blot, Transfection, Ubiquitin Proteomics, Immunoprecipitation, Control

Journal: The Journal of Clinical Investigation

Article Title: CRISPR screening identifies the deubiquitylase ATXN3 as a PD-L1–positive regulator for tumor immune evasion

doi: 10.1172/JCI167728

Figure Lengend Snippet: ( A – C ) WT or ATXN3-KO LLC1 cells were injected subcutaneously into C57BL/6 mice ( n = 10). Tumor growth curve ( A ), photograph ( B ), and weight ( C ) are shown. ( D ) MFI of surface PD-L1 on LLC1 tumors ( n = 5). ( E – G ) Quantification of CD4 + ( E ) and CD8 + T cell ( F ) and Treg ( G ) percentages ( n = 5–10). ( H and I ) Quantification of cell-surface PD-1 ( H ) and PD-L1 ( I ) MFI on CD8 + T cells ( n = 5). ( J and K ) Quantification of cell-surface CTLA-4 MFI ( J ) and Tim3 percentage ( K ) in CD8 + T cells ( n = 5). ( L ) MFI of cell-surface LAG3 and percentage in CD8 + T cells ( n = 5). ( M – O ) Intracellular staining of Blimp1 + CD8 + T cell ( M ), EOMES + CD8 + T cell ( N ), and T-bet + CD8 + T cell ( O ) percentage in LLC1 tumors ( n = 5-7). ( P ) Quantification of cell-surface CD44 + CD8 + T cell percentage from LLC1 tumors ( n = 5–10). ( Q ) Apoptotic CD8 + T cells in the tumors were analyzed ( n = 5–7). ( R and S ) Representative flow staining and quantification of intracellular cytokine staining of granzyme B + CD8 + and IFN-γ + CD8 + in CD45 + T cell populations from LLC1 tumors ( n = 5). ( T ) Tumor growth curve and tumor photograph of C57BL/6 mice injected subcutaneously with WT and ATXN3-KO LLC1 cells with or without treatment of anti-CD8 depleting antibodies ( n = 5). ( U ) Left: Tumor cell-surface PD-L1 expression. Right: Tumor growth of WT or ATXN3-KO LLC1 cells stably expressing PD-L1 (as shown in the left plot) in C57BL/6 mice ( n = 5). A and C – S : 2-tailed unpaired t test; T and U : ordinary 1-way ANOVA. * P < 0.05, ** P < 0.01,*** P < 0.001.

Article Snippet: HEK293T cells were plated in 96-well plates and, the following day, cotransfected with 0.01 μg TK control ( Renilla luciferase), 0.05 μg ATXN3 plasmid, and 0.05 μg CD274 promoter reporter (firefly luciferase, Addgene, 107007) constructs using Lipofectamine 3000 (Invitrogen, catalog L3000150).

Techniques: Injection, Staining, Expressing, Stable Transfection

Journal: The Journal of Clinical Investigation

Article Title: CRISPR screening identifies the deubiquitylase ATXN3 as a PD-L1–positive regulator for tumor immune evasion

doi: 10.1172/JCI167728

Figure Lengend Snippet: ( A ) Representative images from immunohistochemical staining of PD-L1, ATXN3, IRF1, and HIF-2α in human lung adenocarcinoma (LUAD) and melanoma patients. Scale bar: 50 μm. ( B ) PD-L1, ATXN3, IRF1, and HIF-2α protein levels in tumor tissues compared with normal tissues in LUAD patients ( n = 61); “PD-L1%” means the percentage of PD-L1–positive area versus all tissue area. ( C ) PD-L1, ATXN3, IRF1, and HIF-2α protein levels in tumor tissues compared with normal tissues in patients with melanoma ( n = 48). ( D ) Correlation analysis of ATXN3 expression with PD-L1, IRF1, and HIF-2α expression in LUAD patients ( n = 61). ( E ) Correlation analysis of ATXN3 expression with PD-L1, IRF1, and HIF-2α expression in melanoma patients ( n = 48). ( F ) ATXN3 is a positive regulator for PD-L1 transcription through stabilizing multiple transcription factors including HIF-2α, IFR1, STAT3, and JunB and enhances tumor evasion. B and C : 2-tailed unpaired t test; D and E : Pearson’s correlation analysis. ** P < 0.01, *** P < 0.001.

Article Snippet: HEK293T cells were plated in 96-well plates and, the following day, cotransfected with 0.01 μg TK control ( Renilla luciferase), 0.05 μg ATXN3 plasmid, and 0.05 μg CD274 promoter reporter (firefly luciferase, Addgene, 107007) constructs using Lipofectamine 3000 (Invitrogen, catalog L3000150).

Techniques: Immunohistochemical staining, Staining, Expressing